Golden Gate Assembly

Learn the steps involved in Golden Gate assembly and how to efficiently plan and simulate your experiment.

What is Golden Gate Assembly?

Golden Gate assembly, also known as Golden Gate cloning, is a one-pot, one-step cloning procedure created by Carola Engler and colleagues in 2008. The method takes advantage of Type IIS restriction enzymes (e.g. BsaI), which cleave DNA outside their recognition sequences. The result is an ordered assembly of a vector and one or more DNA fragments.

SnapGene Academy Logo

► Golden Gate Assembly videos on SnapGene Academy

How Does Golden Gate Assembly Work?

Golden Gate assembly can be split into two distinct steps that occur within the same reaction: 

  1. Type IIS restriction enzyme digestion 
  2. DNA ligation

Step 1: Type IIS Restriction Enzyme Digestion

The destination vector and insert fragment(s) both contain compatible Type IIS restriction sites.

Golden Gate cloningGolden gate single insert cloning

Unlike conventional restriction cloning, which utilizes Type IIP restriction enzymes that recognize a palindromic sequence and cleaves within the recognition site, Golden Gate assembly uses Type IIS restriction enzymes.

Type IIS restriction enzymes have various unique properties that make Golden Gate assembly possible.

  • Non-palindromic recognition site: The recognition site is non-palindromic. In general, sites range from 4 to 7 nucleotides 
  • Shifted cleavage: Cleavage is performed outside the recognition site. The shifted cleavage site allows for sequences to be digested for cloning without disruption of important sequences 
  • Variable sticky ends: Cleavage on each strand is staggered, resulting in unique overhangs (1 to 5 nucleotides) associated with a single recognition site. For example, with a 4-base overhang, up to 256 different overhang sequences are possible, which enables multiple DNA fragments to be assembled in the same reaction. The unique four base pair overhangs are often referred to as Fusion Sites.
Type IIP v. Type IISType IIP v. Type IIS restriction enzymes

Type IIS restriction enzymes exhibit great diversity in the length of their recognition site, the offset of the cleavage site from the recognition site, and the nature of the overhang; see this list for a complete picture of this diversity.

► Learn more about restriction cloning

Step 2: DNA Ligation

Once the destination vector and DNA insert(s) are digested, their complementary overhangs are joined together by DNA ligase to create an ordered assembly. The process is often denoted as “scarless” or “seamless” since undesired nucleotides are not added between the DNA fragments and the restriction sites are eliminated in the final construct.

Golden gate with multisiteMulti-insert golden gate cloning

Components of Golden Gate Assembly

Golden Gate assembly works by mixing the following components into a single reaction tube:

  • Destination vector
  • DNA insert(s) (e.g. amplicon or pre-cloned)
  • Type IIS restriction enzyme (e.g. BsaI)
  • T4 DNA ligase
  • Reaction buffer

Gateway Reactions are processed in a thermocycler. Assemblies of more than 3 fragments will cycle through reaction temperatures to achieve optimal cloning outcomes.

Destination Vector

Golden Gate destination vectors are available either through commercial sites (e.g. New England Biolabs), individual labs, or Addgene

Alternatively, you can adapt your own vector to be Golden Gate ready. The vector should contain two Type IIS recognition sites (e.g. BsaI) that flank the desired insert region and a screening marker (e.g. lacZ).  The enzyme recognition sites must be oriented with an “outward” orientation so that after digestion the insert and the enzyme’s recognition sites are removed from the vector. 

It’s critical to remove undesired Type IIS cleavage sites from your destination vector; this is known as domestication. If your vector does contain unwanted cleavage sites within the backbone, you will need to remove these before starting Golden Gate assembly. Unwanted cleavage sites can be easily removed with site-directed mutagenesis.

► Watch a video on site-directed mutagenesis

Golden gate destination vectorGolden gate destination vector

DNA Insert(s)

Any double-stranded piece of DNA can be used as the source of insert for Golden Gate Assembly, including both PCR product and plasmid DNA. 

A fragment of interest is adapted for Golden Gate Assembly by the addition of Type IIS restriction sites. Recognition sites must be oriented with an “inward orientation” so that after cleavage the Type IIS recognition site is removed from your fragment.

Golden gate DNA insertGolden gate DNA insert

For amplicon preparation, PCR primers are designed that contain flanking bases, the Type IIS recognition site and an overhang sequence. After amplification, the PCR product can either be cloned into a Golden Gate Destination vector or into a Golden Gate Entry Vector, such as pGGA, for sequence verification and re-use in multiple experiments.

SnapGene primers
  • Forward Primer: 5’ tt GGTCTC a GGAG attcacacccaaaacattc
  • Reverse Primer: 5’ tt GGTCTC g ATGG atcaactgaattgaaaagag 

As with the destination vector preparation, it’s also important that your DNA insert(s) do not contain extraneous Type IIS restriction sites. Unwanted cleavage sites can be removed with site-directed mutagenesis. If the Type IIS recognition site is in a coding sequence, the mutation(s) you introduce must be silent.

Golden Gate Assembly-Based Kits

There are various pre-designed kits available that utilize Golden Gate technology, such as transcription activator-like effector nucleases (TALENs), Golden GATEway and modular cloning (MoClo).


Thomas Cermak and colleagues first described the design and assembly of custom TALEN constructs in 2011. TALENs are fusions of transcription activator-like (TAL) effectors to a Type IIS restriction endonuclease (e.g. FokI), which is achieved through Golden Gate assembly. TAL effectors contain a customizable array of amino acid repeats that bind to desired regions of DNA. Once bound to DNA, the fused nuclease creates a targeted double-strand break. An alternative to CRISPR, TALENs are useful genome engineering tools that can be used to create gene knockouts or introduce specific DNA sequence modifications.

Golden GATEway Cloning

Golden GATEway cloning kits combine the efficiency of Golden Gate assembly with the sequence-independent approach of Multisite Gateway™ cloning. 

As described by Stephan Kirchmaier and colleagues in PLOS One, fragments of interest are cloned into one of eight Golden Gate entry vectors. The elements in the GG-entry vectors are then assembled in one of three Golden Gate destination vectors. The Golden Gate destination clones play a dual role and function as entry clones for three-part Multisite Gateway cloning.

► Learn more about Gateway™ cloning


The MoClo system is a hierarchical approach introduced by Ernst Weber and colleagues that enables the creation of multigene constructs through a series of three Golden Gate assembly reactions.

MoClo kits generally contain three sets of cloning vectors (Level 0, 1, and 2) that allow users to recombine basic modules (e.g. promoters, coding sequences, and terminators) into transcription units, which are later joined to form multigene constructs. The MoClo system can be readily automated for applications such as gene stacking and metabolic engineering.

Tips and Additional Resources

Double-check the orientation and order of your fragments

When performing Golden Gate assembly, it’s very important you take the time beforehand to plan the orientation and order of your DNA fragments. 

It’s recommended to map the Type IIS restriction sites that you will be using and carefully annotate the fusion sequence associated with each site. When using primers to introduce Type IIS restriction sites to amplicons or pre-cloned plasmids, ensure the recognition sites face inwards (i.e. towards your DNA insert). As you process your cloning strategy, you will need to be sure that the selected fusion sites will ultimately assemble your fragments of interest in the correct order.

Consider different Type IIS restriction enzymes

If your vector backbone or insert fragments contain unwanted Type IIS restriction sites, then also consider using an alternative enzyme. It’s more likely to discover internal sites with Type IIS enzymes that have a shorter recognition site (e.g. MnII, 4 bases), compared with those with a longer recognition site (e.g. BaeI, 7 bases).

Commercially available Golden Gate assembly components

Learn More

► Simulating Cloning in SnapGene

A video series on how to simulate a range of cloning techniques in SnapGene

Discover the most user-friendly molecular biology experience